A minimal example dataset is provided called toy1, which can be downloaded with:
rebar dataset download --name toy1 --tag custom --output-dir dataset/toy1
A rebar dataset consists of two mandatory parts:
reference.fasta: The reference genome.
>Reference
AAAAAAAAAAAAAAAAAAAA
populations.fasta: Known populations (ex. clades, lineages) aligned to the reference.
>A
CCCCCCAACCCCCCCCCCCC
>B
TTTTTTTTTTTTTTTTTTAA
>C
AAGGGGGGGGGGGGGGGGGG
>D
CCCCCCAACCCTTTTTTTAA
>E
AAGCCCAACCCTTTTTTTAA
The following are optional components:
annotations.tsv: A table of genome annotations to add to the plot.
| gene | abbreviation | start | end |
|---|---|---|---|
| Gene1 | g1 | 1 | 3 |
| Gene2 | g2 | 12 | 20 |
phylogeny.json: A phylogenetic graph which provides prior information about the evolutionary history. This is particularly useful if populations in populations.fasta are internal nodes or known recombinants.
For example, an evolutionary history, in which population D is a recombinant, and E is a recursive recombinant (it has a parent that is also a recombinant).
graph LR;
root-->A;
root-->B;
root-->C;
A-->D;
B-->D;
C-->E;
D-->E;
style D fill:#00758f
style E fill:#00758f
Is represented by the following phylogenetic graph:
{
"graph": {
"nodes": ["root", "A", "B", "C", "D", "E" ],
"edge_property": "directed",
"edges": [
[ 0, 1, 1 ],
[ 0, 2, 1 ],
[ 0, 3, 1 ],
[ 1, 4, 1 ],
[ 2, 4, 1 ],
[ 4, 5, 1 ],
[ 3, 5, 1 ]
]
}
}
Where nodes are the list of node names in the tree (internal and external), and edges are the branches between nodes. For example, the edge [0, 1, 1] connects node index 0 (“root”) to node index 1 (“A”) with a branch length of 1. Please note that branch lengths are not currently used in rebar's algorithm.
edge_cases.json: A list of rebar arguments to apply only to a particular population.
In the dataset, E is a recursive recombinant between population C and recombinant D. However, we could instead force it to be a recombinant between A, B, and C with the following parameters:
[
{
"population": "E",
"parents": [ "A", "B", "C"],
"knockout": null,
"mask": [0, 0],
"max_iter": 3,
"max_parents": 3,
"min_parents": 3,
"min_consecutive": 3,
"min_length": 3,
"min_subs": 1,
"naive": false
}
]
| Default | Edge Case |
|---|---|
![]() |
![]() |