Signature Format

The signatures produced by Neptune are output in FASTA format with additional information in the description line. Signatures are output in the following format:

>[ID] [SCORE] [IN SCORE] [EX SCORE] [LENGTH] [REF] [POS]
[SEQUENCE]

The following is an example:

>425 score=0.86 in=0.98 ex=-0.13 len=31 ref=ecoli pos=160
TGTCATTCTCCTGTTCTGCCTGTATCACTGC

Where:

Item	Full Name	Description
[ID]	ID	An arbitrary, run-unique ID assigned to the signature.
[SCORE]	Score	The total signature score. This is the sum of the inclusion (sensitivity) and exclusion (specificity) scores.
[IN SCORE]	Inclusion Score	The positive inclusion component of signature score (sensitivity).
[EX SCORE]	Exclusion Score	The negative exclusion component of signature score (specificity).
[LENGTH]	Length	The signature length in bases.
[REF]	Reference	The unique identifier of the contig from which the signature was extracted.
[POS]	Position	The starting position of the signature in the reference.
[SEQUENCE]	Sequence	The sequence content of the signature.

ID

The signature ID is an arbitrary, run-unique ID assigned to the signature. The signatures within the same FASTA file will have unique IDs, relative to each other. However, signatures within multiple output files will have overlapping signature IDs. This will be the case when using multiple references or not specifying any reference files. The signatures within the consolidated.fasta output will have unique signature IDs.

Total Score

Signatures are assigned a score corresponding to their highest-scoring BLAST alignments with all inclusion and exclusion targets, which is a sum of the positive inclusion score (sensitivity) and the negative exclusion component (specificity). This score is maximized when all inclusion targets contain a region exactly matching the entire signature and there exists no exclusion targets that match the signature.

Inclusion Score

The inclusion score is a non-negative number between 0.00 and 1.00 and relates to the signature's sensitivity. This score is determined by the signature's highest-scoring BLAST alignments with all inclusion targets. The inclusion score is maximized (good) when the signature is found exactly and completely in all inclusion targets and minimized (bad) when the signature is not found whatsoever in any inclusion targets.

Exclusion Score

The exclusion score is a non-positive number between -1.00 and 0.00 and relates to the signature's specificity. This score is determined by the signature's highest-scoring BLAST alignments with all exclusion targets. The exclusion score is maximized (bad) when the signature is found exactly and completely in all exclusion targets and minimized (good) when the signature is not found whatsoever in any exclusion targets.

Length

The length describes the length of the signature in bases. Although this can be calculated from the sequence, it is included in the FASTA description to accommodate other tools.

Reference

The reference describes the sequence identifier of the contig the signature was extracted from. This is useful for determining where the signature lies and what sequence surrounds it.

Position

The position describes the base position of the signature within the contig reference it was extracted from. This is useful for determining where the signature lies and what sequence surrounds it.

Sequence

The sequence describes the sequence content of the signature and follows the specifications of FASTA format. However, the sequence will not contain line breaks, regardless of the sequence length.